摘要 |
<p>A probe set and a probe-immobilized carrier are provided to identify simultaneously and more reliably at least two fungi among nine fungi of Candida albicans, Candida glabrata, Candida guilliermondii, Candida krusei, Candida parapsilosis, Cryptococcus neoformans, Trichosporon beigelii, Aspergillus fumigatus and Aspergillus niger with lowered cross-contamination level. A probe set for detecting an infectious etiologic microorganism gene is characterized in that it includes a first probe selected from third to ninth groups, and a second probe belonging to the third to ninth groups and different from the first probe; or a third probe having a sequence complementary to the first probe and a fourth probe having a sequence complementary to the second probe, where the third group comprises a probe having a base sequence comprising gatacagggccctttcgggtct(SEQ ID : NO.11); a probe having a base sequence comprising ttttggcgagtactggacccaac(SEQ ID : NO.12); a probe having a base sequence comprising ctaaccattcgcccttgtggtgtt(SEQ ID : NO.13); a probe having a base sequence comprising atcgggtgttgttctttttttgacgc(SEQ ID : NO.14); and a probe having a base sequence comprising aaatagtgctgctagcttttgctggt(SEQ ID : NO.15); a fourth group comprises a probe having a base sequence comprising atataacgatacagggcctttggtcttg(SEQ ID : NO.16); a probe having a base sequence comprising ggcggacggtctacctatggtaa(SEQ ID : NO.17); a probe having a base sequence comprising accaggacgattactttgaggaaattaga(SEQ ID : NO.18); a probe having a base sequence comprising ggtggtgctactttgcccactc(SEQ ID : NO.19); a probe having a base sequence comprising agacttctcttgatcttacgggtggt(SEQ ID : NO.20); and a probe having a base sequence comprising aaatagggctgcgagcatctgc(SEQ ID : NO.21); fifth group comprises a probe having a base sequence comprising gccggtccatcttttttgatgcgta(SEQ ID : NO.22); a probe having a base sequence comprising tctggctagcctttttggcgaac(SEQ ID : NO.23); a probe having a base sequence comprising tcagtattcagtagtcagaggcgaaattc(SEQ ID : NO.24); a probe having a base sequence comprising tgttgttcttttattgacgcaatcggc(SEQ ID : NO.25); and a probe having a base sequence comprising tgctgctagcatttgctggtatagtc(SEQ ID : NO.26); sixth group comprises a probe having a base sequence comprising acaatacagggctcttttgggcc(SEQ ID : NO.27); a probe having a base sequence comprising ctggtggtcctgtatgctctttactg(SEQ ID : NO.28); a probe having a base sequence comprising ttgacggaagaccaacaactgcg(SEQ ID : NO.29); a probe having a base sequence comprising gatcggcccacgtcaatctctg(SEQ ID : NO.30); and a probe having a base sequence comprising cggcgtctagtcgacggaagtt(SEQ ID : NO.31); seventh group comprises a probe having a base sequence comprising gaggaacggtctgccttacggta(SEQ ID : NO.32); a probe having a base sequence comprising ttcattgagtgtgcggtggaacc(SEQ ID : NO.33); a probe having a base sequence comprising cttagatttacggaagactaacaactgcg(SEQ ID : NO.34); a probe having a base sequence comprising tcggtccacgttattttctgactgga(SEQ ID : NO.35); and a probe having a base sequence comprising ggactaacagcgtttagctgttggaa(SEQ ID : NO.36); eighth group comprises a probe having a base sequence comprising ttctggggaacctcatggcctt(SEQ ID : NO.37); a probe having a base sequence comprising atagggatagtcgggggcgtca(SEQ ID : NO.38); a probe having a base sequence comprising aaagcattcgccaaggatgttttcattaa(SEQ ID : NO.39); a probe having a base sequence comprising cggtgtttctatgatgacccgctc(SEQ ID : NO.40); and a probe having a base sequence comprising cttcttagggggactatcggctca (SEQ ID : NO.41); and ninth group comprises a probe having a base sequence comprising ggggctcttttgggtctcgtaatt(SEQ ID : NO.42); a probe having a base sequence comprising ctggggaatctcatggccttcac(SEQ ID : NO.43); a probe having a base sequence comprising ggatagtcgggggcgtcagtatt(SEQ ID : NO.44); a probe having a base sequence comprising gtgtttctattatgacccgttcggca(SEQ ID : NO.45); and a probe having a base sequence comprising agacctcggcccttaaatagccc(SEQ ID : NO.46).</p> |