摘要 |
PROBLEM TO BE SOLVED: To provide a new biomarker for detecting renal coloboma syndrome disease by gene analysis.SOLUTION: There is provided a method for detecting renal coloboma syndrome in which one or more of the following gene abnormality is detected. More specifically, 119-th and 120-th bases GC are deleted in a coding region of human PAX2 gene. A base C is substituted for a 212-th base G: 58 to 64-th bases "GTGAACC" are duplicately inserted: a base A is substituted for 187-th base G: 224-th and 225-th bases "CC" are duplicately inserted: a base A is substituted for a 1023-rd base C: a base T is substituted for a 2814-th base C in a coding region of a human SALL4 gene: a base T is substituted for a 1565-th base G in a coding region of a human CHD7 gene: a base A is substituted for a 569-th base T in a coding region of a human SIX4 gene: 5489-th to 5510-th bases "ACCTCGCCCCCCAGCTCCGGGG" in a coding region of a human KIF26B gene are deleted.SELECTED DRAWING: Figure 2 |