摘要 |
Disclosed is an immunostimulatory nucleic acid molecule of Formula I: Z1[(X1Y1R1)N(X2Y2R2)kZ2]p(S1)qN'(Nn).(N2)(N1)S2(N1#)(N2#).(Nn#)Z3 wherein each of Z1, Z2, and Z3 is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or an abasic dSpacer; each of X1 and X2 is independently a nucleotide containing thymine, uracil, adenine, or a 5-substituted uracil; each of Y1 and Y2 is independently a cytosine (C) or a modified cytosine; each of RI and R2 is independently a guanine (G) or a modified guanine; each of N and N' is independently any sequence 0 to 12 nucleotides long which optionally comprises a non-nucleotidic linker or abasic dSpacer; S1 is a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, which optionally provides for 2'5'-, 5'5'-, 3'3'-, 2'2'-, or 2'3'- internucleoside linkages; S2 is any non-palindromic sequence 1 to 10 nucleotides long or a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units; each of N1, N2, .... Nn, and N1#, N2#, ...Nn# is any nucleotide or modified nucleotide wherein N1 base-pairs with N1#, N2 base-pairs with N2#, ... and Nn base-pairs with Nn#; k is an integer from 0 to 5; n is an integer from 2 to 16; p is an integer from 1 to 6; and q is an integer from 0 to 10, and wherein when (Nn).( N2)(N1) S2 (N1#)...(Nn#) is 10 to 42 nucleotides long, S2 is 4 to 10 nucleotides long, S2 comprises a non-nucleotidic linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, and/or (Nn).( N2)(N1) S2 (N1#)...(Nn#) has a GC content that is less than 2/3, wherein the nucleic acid molecule is not TCGTCGTTTTACGGCGCCGTTGCCG (SEQ ID NO:44)
|
申请人 |
COLEY PHARMACEUTICAL GMBH;COLEY PHARMACEUTICAL GROUP, INC. |
发明人 |
UHLMAN, EUGEN;VOLLMER, JOERG;KRIEG, ARTHUR M;NOLL, BERNHARD O |