Recombinant vaccine against bluetongue virus

摘要

The present invention relates to an immunogenic or vaccine composition to induce an immune response or protective immune response against Orbiviruses, more specifically bluetongue virus (BTV) in an animal susceptible to BTV infection. The composition may include a pharmaceutically or veterinarily acceptable vehicle or excipient, and a vector. The vector may contain heterologous nucleic acid molecule(s), expresses in vivo in the animal BTV antigen, immunogen or epitope thereof, e.g., BTV VP2; BTV VP2 and VP5; BTV VP2 and VP5 and VP3 and/or VP7. The composition can contain an adjuvant, such as carbomer. Methods for making and using such a composition, including prime-boost regimes and including as to differential diagnosis, are also contemplated.
AGACAGTGGTCAATTCCAATGGTACTGTTTGACGATAC