Method and compositions comprising small RNA agonist and antagonists to modulate inflammation

摘要

The disclosure provides methods and compositions for modulating inflammation.

主权项

1. A composition comprising a nucleotide sequence selected from the group consisting of:
(i) loop “a” of U1 snRNA consisting of GGGAGAACCAUGAUCACGAAGGUGGUUUUCCC (SEQ ID NO:2); (ii) loop “b” of U1 snRNA consisting of GGGCGAGGCUUAUCCAUUGCACUCCGGAUGUGCUGACCCC (SEQ ID NO:3); (iii) a fragment of a loop “c” of U1 snRNA consisting of 10-26 nucleotides of CGAUUUCCCCAAAUGUGGGAAACUCG (SEQ ID NO:4); (iv) any of the foregoing sequences wherein U is T; (v) complements of any of the foregoing sequences; (vi) any of the foregoing sequences comprising a non-natural nucleotide; and (vii) an oligonucleotide having 99% identity with any of the foregoing sequences wherein the oligonucleotide can stimulate IL-6 and/or TNF α production in a mammalian cell, wherein the nucleotide sequence is chemically linked to a charge neutralizing agent and wherein the composition comprises a pharmaceutically acceptable carrier.