High throughput methylation detection method

摘要

Provided is a high throughput methylation detection method, particularly a combined sequence capture and bisulfite sequencing method. The method accurately and effectively analyzes the methylation status of the target area in several samples simultaneously, lowers the difficulty of probe design, enhances operation and application feasibility, and enables high throughput methylation detection of high accuracy on interested target sequences and areas in a complete genome. The method is targeted and conserves energy and time.

主权项

1. A method of constructing a sequencing-library, comprising:
fragmenting a nucleic acid sample, to obtain a nucleic acid fragment; ligating the nucleic acid fragment to an adaptor, to obtain a nucleic acid fragment ligated to the adaptor; subjecting the nucleic acid fragment ligated to the adaptor to sequence capturing using a probe, to obtain a nucleic acid fragment from a predetermined region; subjecting the nucleic acid fragment from the predetermined region to a bisulfite treatment, to convert an unmethylated cytosine in the nucleic acid fragment from the predetermined region to a uracil, to obtain a converted nucleic acid fragment; and amplifying the converted nucleic acid fragment, to obtain an amplified product, wherein the amplified product constitutes the sequencing-library, wherein ligating the nucleic acid fragment to the adaptor further comprises:
end-repairing the nucleic acid fragment, to obtain an end-repaired nucleic acid fragment;adding a base A to the end-repaired nucleic acid fragment at 3′-end to obtain a nucleic acid fragment having the base A at 3′-end; andligating the nucleic acid fragment having the base A at 3′-end to a Paired-end Index (PEI) methylated adaptor, to obtain the nucleic acid fragment ligated to the adaptor, wherein the PEI methylated adaptor is at least one selected from:(SEQ ID NO: 1)Phos/TCAAGTAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC,and(SEQ ID NO: 2)TACACTCTTTCCCTACACGACGCTCTTCCGATCTACTTGAT, wherein all bases C of the PEI methylated adaptor are modified by methylation, wherein the nucleic acid fragment is end-repaired using T4 DNA polymerase, Klenow fragment and T4 polynucleotide kinase, wherein the base A is added to the end-repaired nucleic acid fragment at 3′-end using Klenow fragment (3′-5′ exo-) polymerase and dATP, and wherein the nucleic acid fragment having the base A at 3′-end is ligated to the PEI methylated adaptor using T4 DNA ligase.