| 摘要 |
<p>A method for determining virulence in the infectious pancreatic necrosis virus (IPNV), Sp serotype, in a fish sample comprises (a) determining the presence of IPNV in a fish population by taking a tissue sample from same and selecting those samples with greater viral load; (b) extracting the RNA from the samples selected in step (a); (c) amplifying the discrete region of the VP2 protein that contains residues 217 and 221 from an eluate of the RNA extracted in step (b) using the following primers: IPNa1: GGGACGTCATTGTCAAGGCC and IPNs7: CGTCCGCCTAGAGGACGAGAC’; (d) purifying the amplification products obtained in step (c); (e) sequencing the purified amplification product from step (d), translating the nucleotide sequence obtained into an amino acid sequence; and (f) identifying the presence of the threonine or proline residues in position 217 and of the alanine residue in position 221 in the amino acid sequence obtained in step (e) to establish virulence of the IPNV, respectively.</p> |
