Compositions and methods for inhibiting expression of Eg5 gene

摘要

The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Eg5 gene (Eg5 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the Eg5 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Eg5 expression and the expression of the Eg5 gene using the pharmaceutical composition; and methods for inhibiting the expression of the Eg5 gene in a cell.

主权项

1. A composition comprising a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of a human kinesin family member 11 (Eg5) gene in a cell, wherein the dsRNA comprises a sense strand comprising a first sequence and an antisense strand comprising a second sequence complementary to 19-24 nucleotides of nucleotides 1066-1101 of NM—004523 (5′ UUCCUUAUCGAGAAUCUAAACUAACUAGAAUCCUCC 3′ SEQ ID NO:1534), wherein the first sequence is complementary to the second sequence and wherein the dsRNA is between 19 and 30 base pairs in length.