摘要 |
FIELD: biotechnology.SUBSTANCE: proposed RNA-aptamer is a 57-unit mixed-type oligonucleotide having the nucleotide sequence GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, where A, G are ribonucleotides, U, C are 2'-desoxy-2'-fluoro-ribonucleotides, has the ability to recognise autoantibodies specific to disseminated sclerosis.EFFECT: characterised invention binds specifically and highly affine with autoantibodies specific to disseminated sclerosis, and can be used for the diagnostics of disseminated sclerosis.3 dwg, 2 ex |