Modulation of transthyretin expression

摘要

Disclosed is a single-stranded modified oligonucleotide consisting of 20 to 30 linked nucleosides, wherein the modified oligonucleotide comprises: a gap segment consisting of linked deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar, and wherein the linked nucleosides have a nucleobase sequence comprising the sequence recited in SEQ ID NO: 80 (tcttggttacatgaaatccc).