RNA aptamer specifically binding to carcinoembryonic antigen and use thereof

摘要

Provided are RNA aptamer specifically binding to cancer metastasis-inducing domain of CEA (Carcinoembryonic antigen), a composition for prevention and/or inhibition and/or diagnosis of cancer metastasis containing the same as an active ingredient, and a method of prevention and/or inhibition and/or diagnosis of cancer metastasis using the same.

主权项

1. A method for preventing or inhibiting cancer metastasis, the method comprising administering an RNA aptamer to a patient in need of inhibition of metastasis,
wherein the RNA aptamer is 35 to 49 bases in length and binds to a linkage region between N domain and A1 domain of carcinoembryonic antigen (CEA), and the RNA aptamer comprises continuous 35 or more bases comprising the nucleotide sequence from 9th to 43rd positions of following SEQ ID NO: 13: GCGGAAGCGUGCUGGGCUAGAAUAAUAAUAAGAAAACCAGUACUUUCGU; and wherein C_(cytosine) and U_(uracil) in the RNA aptamer is modified by substituting 2′ hydroxyl group with fluoro group.