摘要 |
The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19. |