DISCRIMINATION OF BLOOD TYPE VARIANTS

摘要

The present invention provides a method for detecting the presence or absence of, or for discriminating between, blood type variants, including RHD*r′s, RHD*DIIIa and RHD*DIVa-2. The method comprises amplifying by PCR a sample obtained from a human subject at intron 3 of the RHD gene locus. The invention also provides products, in particular, probes, primers and kits for use in the method of the invention.

主权项

1. An oligonucleotide polymerase chain reaction (PCR) primer, the nucleotide sequence of which is of the formula:
X—Y—Z wherein: X is X1 or X2, wherein:
X1 is the final n nucleotides of the nucleotide sequence ATATGGAAATTTGATCATGT (SEQ ID NO: 1), wherein n is a number between 0 and 20, inclusive; andX2 is a variant of X1 differing by no more than one nucleotide substitution; Y is Y1 or Y2, wherein:
Y1 is the nucleotide sequence AS1TAATS2ATAC (SEQ ID NO: 2), wherein S1 and S2 are independently selected from G and C; andY2 is a variant of Y1 differing from Y1 by no more than one nucleotide substitution, provided that said nucleotide substitution is not a substitution of the first A or final C of Y1; Z is the first m nucleotides in the nucleotide sequence TAAAG, wherein m is a number between 0 and 5, inclusive.