| 摘要 |
<p>Disclosed is an oligonucleotide consisting of a nucleotide sequence of GTCAAGGCACTCTTGCCTAAGT (SEQ ID NO:1) or an oligonucleotide substantially identical thereto, wherein the substantially identical oligonucleotide has at least 90% sequence identity with the oligonucleotide of SEQ ID NO:1, and wherein there is no mismatch in the five nucleotides at the 3’end. Further disclosed are methods of detecting KRAS mutations using said reverse primer and the forward primer consisting the nucleotide sequence GGCCTGCTGAAAATGACTGA (SEQ ID NO: 2) for detecting a mutation in codon 13 in exon 2 of the KRAS gene.</p> |
