| 摘要 |
The invention relates to the fields of molecular biology and medicine, more specifically to treatment and prevention of heart disease. The invention provides alternative methods for counteracting, diminishing, treating, delaying and/or preventing heart disease. More in particular, it provides a nucleic acid sequence with a length of at least 19 nucleotides with at least 90% sequence identity to a nucleic acid comprising at least 19 consecutive nucleotides of the sequence ACAGCAGGCACAGACAGGCAGU or the complement thereof, for use in treating, diminishing, delaying and/or preventing heart disease. |
