摘要 |
Calibrating the control of a thermal block of thermal cycler for PCR, comprises: (a) placing set of sensors for measuring temperature in slots for reaction mixing tube selected in the thermal block; (b) starting the thermal cycler, under normal use, for at least one cycle programmed with temperature set points for a PCR reaction, and (c) measuring the temperature values with each of measuring sensors, at many points in time, simultaneously in step (b). Process for calibrating the control of a thermal block of thermal cycler for PCR, where the thermal block comprises many slots for reaction mixing tubes and many elements for thermal control, comprises: (a) placing a set of sensors for measuring temperature in slots for reaction mixing tube selected in the thermal block, where the sensors for measuring temperature comprises (i) a reaction tube for tested thermal block, (ii) a selected volume of liquid filling at least partially the reaction tube, (iii) a temperature sensor at least partially submerged in the liquid, and (iv) at least one means for linking the temperature probe with means of receiving a signal generated by the thermal sensor, and the slots in which the sensors for measuring temperature are arranged on the surface of the thermal block so that at least two temperature sensors are arranged in each of thermal elements included in the thermal block; (b) starting the thermal cycler, under normal use, for at least one cycle programmed with temperature set points for a PCR reaction, and (c) measuring the temperature values with each of measuring sensors, at many points in time, simultaneously in step (b). Independent claims are included for: (1) a process for testing the heat control of thermal cycler for PCR, comprising carrying out the process of testing physical calibration and carrying out a biological calibration test, using many primer pairs each having a known and different optimum temperature of hybridization; (2) a sensor for measuring the temperature of a thermal block well of a PCR thermocycler comprising a reaction tube used in the tested heat block, a selected volume of liquid filling at least partially the reaction tube, a temperature sensor at least partially submerged in the liquid, and at least one means for linking the temperature probe with means of receiving a signal generated by the thermal sensor; (3) a system for testing thermal control of a thermal cycler device for PCR, comprising many sensors for measuring temperature and at least one means of receiving signal for measuring the temperature generated by each of the sensors; (4) a composition of nucleotide primers for carrying out step (b) of the process comprising combined or separated nucleotide having primer pairs comprising a pair of primers of SEQ ID NO: 1 (cacacttcatatttacccat) and SEQ ID NO: 2 (ttgtttaatagagacgaagg) having an optimal hybridization temperature of 50[deg] C, a pair of primers of SEQ ID NO: 3 (atggacatttacggtagtgg) and SEQ ID NO: 4 (aagtatttcaatgccggtag) having optimal hybridization temperature of 55[deg] C, a pair of primers of SEQ ID NO: 5 (gctagctgtaactggagccg) and SEQ ID NO: 6 (gtctgctgaaactgccaaca) having optimal hybridization temperature of 60[deg] C, and a pair of primers of SEQ ID NO: 7 (ggcctgctgaaaatgactga) and SEQ ID NO: 8 (caaaacaaaacaatatatacattccaa) having optimal hybridization temperature of 65[deg] C; and (5) a pair of primers of SEQ ID NO. 7 and SEQ ID NO. 8. |