| 摘要 |
A universal method and primers (and kits thereof) for the amplification of any prokaryote. 16S ribosomal RNA or DNA comprises the primer TCCTACGGGAGGCAGCAG (SEQ ID NO 1, `MangalaF-1') and the primer CGGTTACCTTGTTACGACTT (SEQ ID NO 2, `16SU1510R'). Also disclosed are methods for verifying the identity of a prokaryotic organism by the use of species/strain specific hybridization probes or specific nucleic acid amplifications when used in conjunction with the 16S amplification method. |
