| 摘要 |
<P>PROBLEM TO BE SOLVED: To provide an RNA aptamer molecule capable of binding to sphingosylphosphorylcholine (SPC). <P>SOLUTION: The RNA aptamer molecule capable of binding to the sphingosylphosphorylcholine (SPC), e.g. SPC-198: 5'-GGGAAUGGAUCCACAUCUACGAAUUC UACCGUUAUUGGUGUCACCGAAGAUGUUA UUCACUGCAGACUUGACGAAGCUU-3', contains a consensus sequence of 5'-CCGUUAUUGG-3' that can form a hairpin structure as a part thereof, and the hairpin structure moiety can be utilized for the formation of a specific complex with sphingosylphosphorylcholine (SPC). <P>COPYRIGHT: (C)2011,JPO&INPIT |
