Development of diagnostic kit for the detection of Chrysanthemum virus B

摘要

The present invention provides a method for detection of Chrysanthemum virus B in plants using desined primers of Sequence ID 1: Upstream primer TGCCTCCCAAACCGGCACCAGGTGAT Sequence ID 2: Downstream primer: TTTATAATGTCTTATTATTCGCAT It also relates to a diagnostic kit useful for detection of coat protein of Chrysanthemum virus B in plants comprising: polyclonal antibodies against Chrysanthemum virus B coat protein in plants; conjugate labeled with alkaline phosphatase; coating buffer; extraction buffer; ECI buffer; PNP buffer.