| 摘要 |
The present invention provides a method for molecular detection and quantification of Mycobacterium Avium subspecies Paratuberculosis (MAP) by means of duplex competitive real time polymerase chain reaction (PCR) with , an internal amplification controls wherein the invention is characterized in that detection and quantification of MAP is performed with primers and hydrolyzation probes, which amplify two loci specific for MAP: i.e. IS900 and F57 in samples of animal and vegetable origin of the following composition: primers for F57; F57qPCRF GCCCATTTCATCGATACCC, F57qPCRF GTACCGAATGTTGTTGTGTCAC, probes for F57; F57qPCRTM FAM-CAATTCTCAGCTGCAACTCGAACACAC-BHQ, primers for IS900; IS900qPCRF GATGGCCGAAGGAGATTG, IS900qPCRF CACAACCACCTCCGTAACC, probes for IS900; IS900qPCRtM FAM-ATTGGATCGCTGTGTAAGGACACGT-BHQ, whereas the composition of the probe for the internal amplification control is as follows: IACqPCRTM Cy5-GGCTCTTCTATGTTCTGACCTTGTTGGA-BHQ. |
