摘要 |
<p>Decoy oligonucleotides (I) having any of the 39 nucleotide sequences defined in the specification. An independent claim is also included for three antisense molecules (II) selected from S1, S2, and S3. TACCACTGAGACATCCTGCCAC (S1); AACATCATTGGCACGCAG (S2); GTGAACCTGCTCCAG (S3). ACTIVITY : Vasotropic; Immunosuppressive; Antidiabetic; Neuroprotective; Antiallergic; Antirheumatic; Antiinflammatory; Dermatological; Antiarthritic; Antiasthmatic; Antipsoriatic; Antibacterial. Guinea pigs were sensitized to dinitrochlorobenzene (DNCB), then treated again with DNCB to induce contact dermatitis. Intradermal injection of the STAT-1 decoy oligonucleotide (TGTGAATTACCGGAAGTG) 1 hour before final exposure to DNCB caused a significant reduction in edema, the number of apoptotic cells and leucocyte infiltration, i.e. significant suppression of the inflammatory response. MECHANISM OF ACTION : Neutralization, or inhibiting expression of, STAT-1, and thus of a range of potentially proinflammatory gene products in leucocytes, endothelial and smooth muscle cells. Genes that have a STAT-1 binding site in their promoters include those for CD40, E-selectin, inducible nitric oxide synthase (NOS), interleukin-12 and interferon-gamma . Also (I) may lift inhibition of gene expression where this is blocked by transcription factors, e.g. the gene for endothelial NOS which is down regulated by interferon-gamma .</p> |