摘要 |
A primer or a primer set can efficiently amplify the gene sequence of 16S rRNA of a target bacterium out of selected sixty two bacterium species. At least one of the primers having a base sequence selected from sequences No. 1 through No. 6 is employed as bacterium genome amplification reaction primer: <tables id="TABLE-US-00001" num="00001"> <table frame="none" colsep="0" rowsep="0" tabstyle="monospace"> <tgroup align="left" colsep="0" rowsep="0" cols="3"> <colspec colname="1" colwidth="140pt" align="left"/> <colspec colname="2" colwidth="77pt" align="left"/> <colspec colname="3" colwidth="0pt" align="left"/> <tbody valign="top"> <row> <entry>(1) GCGGCGTGCCTAATACATGCAAGTCG</entry> <entry>(sequence No. 1)</entry> <entry/> </row> <row> <entry> </entry> </row> <row> <entry>(2) GCGGCAGGCCTAACACATGCAAGTCG</entry> <entry>(sequence No. 2)</entry> </row> <row> <entry> </entry> </row> <row> <entry>(3) GCGGCAGGCTTAACACATGCAAGTCG</entry> <entry>(sequence No. 3)</entry> </row> <row> <entry> </entry> </row> <row> <entry>(4) ATCCAGCCGCACCTTCCGATACGGC</entry> <entry>(sequence No. 4)</entry> </row> <row> <entry> </entry> </row> <row> <entry>(5) ATCCAACCGCAGGTTCCCCTACGG</entry> <entry>(sequence No. 5)</entry> </row> <row> <entry> </entry> </row> <row> <entry>(6) ATCCAGCCGCAGGTTCCCCTACGG</entry> <entry>(sequence No. 6)</entry> </row> </tbody> </tgroup> </table> </tables>
|