摘要 |
PROBLEM TO BE SOLVED: To provide an anti-sense oligonucleotide having promising usefulness as a therapeutic drug for fragile X syndrome or the like and capable of specifically inhibiting drebrin A expression. SOLUTION: An anti-sense oligonucleotide capable of hybridizing with 24-mer S-oligo(5'-AGGAAGGCCCACTGTCCGATGCCT-3') being an anti-sense chain of aggcatcggacagtgggccttcct (sequence number 5) in ins2 region which specifically exists in drebrin A and the sequence is suitably maintained beyond animal species, and the base sequence represented by the sequence number 5 under a stringent condition and having an inhibitory action on drebrin A expression, and derivatives thereof are produced. |