| 摘要 |
To provide a cancer diagnostic method capable of detecting evidence presenting the presence of cancer cells in early stage cancer. Cancer diagnostic method comprised of; a process to obtain the sample containing RNA only as a somatic cell and cancer cell fraction from body fluid and a process having a reverse transcription reaction step to generate cDNA using reverse transcriptase from the sample containing said RNA only and a PCR reaction step utilizing fluorescent dye using the following primers for hTERT, CGGAAGAGTGTCTGGAGCAA and GGATGAAGCGGAGTCTGGA to quantify the PCR product amplified by the PCR reaction using the fluorescent dye binding to the PCR product.
|
