| 摘要 |
<P>PROBLEM TO BE SOLVED: To make it possible to species-specifically detect Lactobacillus fructivorans by a PCR (polymerase chain reaction) method. <P>SOLUTION: An oligonucleotide which is chemically synthesized to be complementary to a part of a nucleotide sequence encoding the 16 SrRNA of Lactobacillus fructivorans by using the nucleotide sequence as a target and comprises a base sequence represented by the sequence number 1 or 2, is used as a primer for detecting the Lactobacillus fructivorans by the PCR method. (Sequence number 1): (5')AAGATGGCCTTTGTGCTATCG(3'), (Sequence number 2): (5')GATACCGTCGCGACGTGAG(3'). <P>COPYRIGHT: (C)2005,JPO&NCIPI |
