| 摘要 |
<P>PROBLEM TO BE SOLVED: To make it possible to genus-specifically detect a Lactobacillus bacterium by a PCR method. <P>SOLUTION: An oligonucleotide which is chemically synthesized to be complementary to a part of a nucleotide sequence encoding the 16 SrRNA of a Lactobacillus bacterium by using the nucleotide sequence as a target and comprises one of base sequences represented by the sequence numbers 1 to 5, is used as a primer for detecting the Lactobacillus bacterium by a PCR (polymerase chain reaction) method. (Sequence number 1): (5')CGAAGAAGTGCATCGGAAAC(3'), (Sequence number 2): (5')GGAGAAGTGCATCGGAAAC(3'), (Sequence number 3): (5')TTAGGTTAACAGAAGATGTCAAGAC(3'), (Sequence number 4): (5')TTAGGTTGGCAGAAGATGTC(3'), (Sequence number 5): (5')CTTAGATTTGCATAGTATGTCAAGAC(3'). <P>COPYRIGHT: (C)2005,JPO&NCIPI |
