Oligonucleotides, methods and system for the detection of microbial antibiotic-resistence-inducing genes via real-time PCR

摘要

An oligonucleotide (I) comprising a nucleotide sequence chosen from SEQ ID No. 1-8 or SEQ ID No. 9-12, is new. An oligonucleotide (I), comprises a nucleotide sequence chosen from cctccattgagcggcttca (SEQ ID No. 1), gggaatgctggatgcacaa (SEQ ID No. 2), cgcaacgttcaatttaattttgtcaa (SEQ ID No. 3), ctgtgaggtcggttgtgcg (SEQ ID No. 4), gccgtgccccggaa (SEQ ID No. 5), catgacccagttcgccatatc (SEQ ID No. 6), tggtctttctgcattcctgga (SEQ ID No. 7) and tttggtccacdcgcca (SEQ ID No. 8), or caacactacccggaagcacagttcgtc (SEQ ID No. 9), cctatggcgtgaaaaccaacgtgca (SEQ ID No. 10), aatgacgctatgatcccaatctaacttccaca (SEQ ID No. 11) and caactaacgcggcactgtttcccaat (SEQ ID No. 12). Independent claims are also included for: (1) detecting (M1) antibiotic resistance-mediating genes in microorganisms by performing real-time PCR, involves utilizing at least one first oligonucleotide (A) comprising nucleotide sequence chosen from SEQ ID No. 1-8 as primer, and using at least one first dye (C) for detecting the PCR-amplified DNA; (2) system (II) for (M1), comprising a first primer nucleotide sequence (A) chosen from sequences consisting of SEQ ID No. 1-4, a second primer nucleotide sequence (B) chosen from sequences consisting of SEQ ID No. 5-8, with the sequences 1 and 5, 2 and 6, 3 and 7, and 4 and 8 being used as primer pairs, and at least one first dye (C) for detecting the PCR-amplified DNA, where appropriate, a probe nucleotide sequence (D) chosen from sequences consisting of SEQ ID No. 9-12, and a second dye (F) which, when spatially proximal, extinguishes the fluorescence of the first dye (C); and (3) use of a support material, preferably a biochip, which is provided with (II) for (M1).