| 摘要 |
A PCR method for detecting Salmonella, is new. A PCR method for detecting Salmonella comprises: (a) incubating a sample first in peptone broth and then in Rappaport-Vassiliadis medium; (b) extracting DNA; (c) adding oligonucleotide PCR primers, each having a sequence that is specific for Salmonella but unable to cross-react with other organisms; (d) performing PCR; (e) cleaving the amplicon with a restriction enzyme (RE) that has a recognition sequence present at least once in the amplicon; and (f) detecting cleavage products. Independent claims are also included for: (1) the DNA oligonucleotide primers (S1) and (S2); and (2) kit for the process comprising oligonucleotide primers, as specified; PCR reagents, and RE, as specified. tttacggtctattttgatttg (S1) atatgctccacaaggttaatg (S2)
|
