| 摘要 |
The present invention relates to methods for detecting viral pathogens, particularly human herpes virus 6 (HHV6), preferable using polymerase chain reaction (PCR) techniques. The present invention also relates to primer sequences useful in these methods. In a first aspect, the present invention consists in an isolated nucleic acid molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from the group consisting of 5' CTTCTGTTTTACAGGAGT (SEQ ID NO:1). 5'ACAATTGCCATTTCGGGGAAGTAC (SEQ ID N0:2), and functionally equivalent sequences. A method for detecting HHV6 in a sample suspected of containing HHV6, the method comprising the steps of: (a) optionally amplifying viral DNA present in the sample by polymerase chain reaction techniques using outer primers complementary to the viral DNA; (b) adding to the sample or to the sample having undergone optional amplification step (a), a pair of inner oligonucleotide primers complementary to and specific for HHV6 DNA, wherein the inner primers comprise the sequences 5'AAGCTTGCACAATGCCAAAAAACAG and 5'CTCGAGTATGCCGAGACCCCAATC, or functionally equivalent sequences; (c) carrying out polymerase chain reaction techniques on the sample so as to amplify the HHV6 DNA spanned by the inner primers present in the sample: and (d) detecting the amplified HHV6 DNA.
|
