| 摘要 |
<p>The invention relates a promoter comprising or formed by sequence GGCCCAAAATGACCCTTCCCGCCAAAAAGGGTACAGGTTATC (SEQ ID No. 1 from the list of sequences in the appendix) or the complement thereof and, optionally, GCCTTGAGGAAATCAAACGCGCCAAACAAGCGCGTAGACG (SEQ ID No. 2 from the list of sequences in the appendix) or the complement thereof. The invention also relates to expression cassettes and vectors comprising said promoter, plant cells and plants transformed by said expression cassettes and vectors. Moreover, the invention relates to the use of said promoter to induce the expression of a particular gene, at the G1/S transition or in the meristems, to increase the transformation rate and/to increase the inter-specific recombination.</p> |
