Detecting and identifying a mixture of organic materials, useful e.g. for determining adulteration of foods, by detecting cloned mitochondrial or chloroplastic DNA

摘要

Use (M1) of a cloning product (A) for determining existence of a mixture containing mitochondrial or chloroplastic DNA (I) of different species, populations or races, of animals and/or plants, and/or of different human beings, is new. Independent claims are also included for: (1) detecting or identifying (M2) DNA from each of the different species, populations or races, of animals and/or plants, and/or of different human beings present in a mixture; (2) oligonucleotides (ON) at least 80, preferably 95,% identical with sequences (21), (22), (24), (25), (28) or (29); (3) primer pairs (II) comprising ON (21) and (22), (24) and (25), or (28) and (29); and (4) DNA fragments (Ia), of 100-500 bp, produced by amplification using (II). GCCGAATGTAAAGCATCTGG (21); ACCTTATGCACTTGATATCC (22); ACCGGGTCTAATAACCCAGC (24); ATGATAATGAATGGGTGTTC (25); AAAGCTCTGCGCGCTCTACG (28); and CCGCGGAGACATTCATAAAC (29).