Method for the detection and identification of Clavibacter michiganensis

摘要

Oligonucleotides that bind to the 16S-23S rDNA intergenic spacer region of the subspecies of Clavibacter michiganensis which are: (i) any of sequences (1)-(5), of 20-22 nucleotides (nt), fully defined in the specification; (ii) complements of (i); (iii) derivatives of (i) or (ii) that differ in up to 3 nt; and (iv) sequences that include (i)-(iii) or their fragments, are new. Oligonucleotides that bind to the 16S-23S rDNA intergenic spacer region of the subspecies of Clavibacter michiganensis are: (i) any of sequences (1)-(5), of 20-22 nucleotides (nt), fully defined in the specification; (ii) complements of (i); (iii) derivatives of (i) or (ii) that differ in up to 3 nt; and (iv) sequences that include (i)-(iii) or their fragments. Independent claims are also included for the following: (1) a primer pair specific for C. michiganensis nucleic acid and comprising sequences (6) and (7), or their complements, derivatives as above or sequences containing them; (2) specific detection of, and differentiation between, subspecies of C. michiganensis by polymerase chain reaction; and (3) a kit for method (2). TTCCGTCGTCCCTTGAGTGGAT (1) TTCCGTCGTCCTGTTGTGGATG (2) TTCCGTCGTCCTTTCGTGGATG (3) TTCCGTCGTCCCGGAGTGGAT (4) CCGTCGTCCCTGAGTGGATG (5). TGTCGAGGGCATGTTGCACG (6) GGAGACAGAATTGACCAATGAT (7)