摘要 |
The invention concerns an oligonucleotide capable of stimulating human cells of an immune system, characterised in that it comprises at least a nucleotide sequence corresponding to formula 5' GAGAATTCTTTACCTTTTAT3', wherein T represents Thymine, A Adenine, C Cystosine, and G Guanine, and it does not include CG dinucleotide wherein the Cytosine C is unmethylated. Said oligonucleotide is particularly useful as vaccine adjuvant.
|