| 摘要 |
Primer pairs 45-3F + 39-2R (I) and 39-2F + 39'-2R (II) are used to detect the nhe toxin operon, or individual genes of this operon, in Bacillus cereus. Primer pairs 45-3F + 39-2R (I) and 39-2F + 39'-2R (II) are used to detect the nhe toxin operon, or individual genes of this operon, in Bacillus cereus. (I) 5'ACGTTACAAACGTTGAAGTAC3' + 5'CCAATGGTACACAATGGGATC3' (II) 5'CGACTTCTGCTTGTGCTCCTG3' + 5'AAGCCTTTCGTAAGAGTTGC3' Independent claims are also included for the following: (1) use of all other primer combinations based on the sequence of the nhe operon (not disclosed) for detecting the nhe toxin operon, or individual genes of this operon, in Bacillus cereus; (2) use of all polymerase chain reaction (PCR) primers based on the nhe sequence (not disclosed) for detecting the nhe toxin operon, or individual genes of this operon, in all species of the Bacillus cereus group, e.g. B. cereus, B. weihenstephanensis, B. mycoides, B. thuringiensis and B. anthracis; (3) use of a nucleic acid sequence (not disclosed) for detecting any kind of nhe operon, or individual genes thereof.
|
