New primers and probes from the factor V gene, useful for detecting the mutation that causes activated protein C resistance

摘要

Primers (I) derived from the factor V gene are new. (I) have formulae (1), specific for the G to A mutation at position 1691 in exon 10; (2), specific for the wild-type sequence and (3), a reverse primer for use with both (1) and (2): (1) ACA4TACCTGTATTCCAT; (2) ACA4TACCTGTATTCCGC; (3) TCATGAAATAACTTTGCAAATGA . Independent claims are also included for the following: (1) oligonucleotide probes (II) of formulae (4)-(7): (a) TACTTATAAGTGGAACATCTTAGAGTTTGATGAACC; (b) TGCCCAGTGCTTAACAAGACCATACTACAGTGACGT ; (c) UACUUAUAAGUGGAACAUCUUAGAGUUUGAUGAACC; (d) UACUUAUAAGUGGAACAUCUUAGAGUUUGA; (2) sets of primers comprising (3) plus (1) or (2); (3) a method for detecting factor V gene sequences by amplifying sample DNA with both primer sets of (b) and evaluating amplification; and (4) a test kit for detecting APC (activated protein C)-resistance mutations comprising one or more (I) and optionally one or more (II).