Oligonucleotide primers and probes, for the detection of hepatitis B virus, are used to amplify, by polymerase chain reaction, a section of the hepatitis B virus genome

摘要

A method of detecting hepatitis B virus (HBV) in a sample comprising exposing the sample to a polymerase chain reaction (PCR), where the PCR amplified DNA fragment corresponds to part of the HBV genome in the region of positions 242-482 of the HBV genome, counted from the single EcoRI cleavage site in the genome, is new. Independent claims are also included for the following: (1) oligonucleotides chosen from (I)-(IV), and complements of (III) and (IV); (2) a plasmid containing a DNA fragment having a 382 bp sequence, fully defined in the specification; and (3) a test kit to detect HBV containing an oligonucleotide composition, the necessary nucleotides for PCR and a heat stable DNA polymerase. CnAACCTSYGTCCTCCAAYTTGT (I); GATGAGGCATAGCAGCAGGAT (II); AACGCCGCAGACACATCCAGCGAT (III); and ACGACGGACCACACTGACCAGTCA (IV). n = 0 or 1; S = C or G; and Y = C or T.