摘要 |
PROBLEM TO BE SOLVED: To obtain a primer DNA, which forms a part of the DNA sequence coding for protein on the oocyst wall of Cryptosporidium parvum, and useful for specific, high-sensitivity detection of Cryptosporidium parvum. SOLUTION: This primer DNA has a base sequence with at least 10 continuously configured bases, e.g. CGCCTGTTTCTTTAACTTGTCC as a part of the sequence shown by the formula, which is part of the DNA sequence coding for protein on the oocyst wall of Cryptosporidium parvum, or GTGGACATGAAAGAGTTGGTG complementary to a part of the sequence shown by the formula. It can be synthesized by theβ-cyanoethy-phosphoamidite method using a commercial DNA synthesis unit, and purified using a cartridge for oligonucleotide purification. It is useful, e.g. in the medical area (e.g. diagnosis) and also in the environment and food areas (e.g. detection of contamination with Cryptosporidium parvum). Detection sensitivity, peculiarity, handling easiness and the like of Cryptosporidium parvum are improved by marking it with a marking substance or by application of the chain reactions of polymerase.
|