The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4): 5'GAAATGACTGAACGTCCGAT (1> 5'GCGATCAATGTTACCGTAGT (2> 5'AGTATGGGCCAAAGTTCGAT (3> 5'CACTTTGATATGTGGATCCG (4> a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage.
