| 摘要 |
The use of nucleotide sequence Y45 and/or nucleotide sequence Y46 represented by SEQ ID NO 1: TCACCGGACGCCGAACTGTGGCGT and SEQ ID NO 2: TCGCCAACGTTCAGCAGAACAAGT, respectively, for carrying out a method for detecting and specifically identifying Erwinia carotovora subsp. atroseptica (Eca) in a predetermined sample, particularly soil or water, or in a host thought to be a carrier of such bacteria, particularly plants and seeds, as well as, if necessary, carrying out a method for the early diagnosis of diseases thought to be caused by said Eca in the above-mentioned host.
|
