| 摘要 |
PURPOSE:To obtain a new oligo-DNA primer useful for amplifying the nucleic acid of a mushroom such as Armillaria matsudake and Lyophyllum shimeji by PCR process and directly determining the base sequence. CONSTITUTION:This oligo-DNA primer is a primer containing an amplification primer capable of complementarily bonding to a nucleic acid having a conservative sequence common to eucaryote and contained in a DNA coding 18Sr RNA originated from mushroom. The primer has base sequences of e.g. 5' GGTGGTGCATGGCCG3', 5'CCGCAGGTTCACCTAC3' and 5' GCTTGTCTCAAAGATTAAGCC3'. It can be chemically synthesized by a fully automatic DNA synthesizer (e.g. Model 380B, product of Applied Biosystems Inc.). |
