摘要 |
<p>The present invention relates to a method for determining the gender of a human being based on a DNA sample originating from said human being. In one embodiment of the invention, the oligonucleotide primers CTGGAGAGCCACAAGCTGAC (SEQ ID NO:1); and TTGCTGTGGACTGCCAAGAG (SEQ ID NO:2) are used to amplify an approximately 209 base pair conserved region of the X and Y zinc finger protein coding sequence. Then, digestion of the amplified product with a HaeIII restriction enzyme results in distinguishable fragments for female and male samples. The invention also relates to the said oligonucleotide primers per se, preferably in labeled form, to the use of said primers as a diagnostic tool and to a test-kit comprising said oligonucleotide primers.</p> |