摘要 |
A method of interrupting the expression of a macromolecular synthesis operon in bacteria comprising the step of binding an antisense oligonucleotide to a single stranded DNA or to a mRNA transcribed from the macromolecular synthesis operon. The antisense oligonucleotide can be either sequence specific to a unique intergenic sequence or a sequence specific to a bacterial homologous sequence. By interrupting the expression of the macromolecular synthesis operon bacterial infections can be treated. Examples of antisense oligonucleotides are 5'CATCCAAGCAGTGGTAAAACTGTTT 3', 5'TCACCGATCGGCGTTTCCA 3', 5'GGCCCCGATTTTAGCAA 3', 5'CTTGCGTAAGCGCCGGGGG 3', and 5'TATTCGATGCTTTAGTGC 3'. The ability of the antisense oligonucleotide to bind the mRNA or single stranded DNA also allows the identification of the bacteria by using a unique intergenic antisense oligonucleotide to bind to the single stranded DNA or to the mRNA transcribed form the macromolecular synthesis operon. A method for competitively inhibiting the protein products of the MMS operon with oligonucleotides is also disclosed. |