| 摘要 |
A DNA sequence comprising a polynucleotide segment consisting of a DNA sequence (A) shown below and a DNA sequence complementary thereto: GATGTGCAGCTGGTGGAGTCTGGGGGAGGCTTA +TR GTGCAGCCT GGAGGGTCCCGGAAACTCTCCTGTGCAGCCTCT +TR GGATTCACT TTCAGTAGCTTTGGAATGCACTGGGTTCGTCAG +TR GCTCCAGAG AAGGGGCTGGAGTGGGTCGCATATATTAGTGGT +TR GGCAGTTAT ACCATCTACTATGCAGACACAGTGAAGGGCCGA +TR TTCACCATC TCCAGAGACAATCCCAAGAACACCCTGTTCCTA +TR CAAATGACC AGTCTAAGGTCTGAGGACACGGCCATGTATTAC +TR TGTGCAAGT TCCTATGGTAACTTCTGGTACTTCGATGTCTGG +TR GGCGCAGGG ACCACGGTCACCGTCTCCTCA wherein A represents deoxyadenosine-5'-phosphate, C represents deoxycytidine-5'-phosphate, G represents deoxyguanosine-5'-phosphate, and T represents deoxythymidine-5'-phosphate. The DNA sequence provided by this invention is derived from a rearranged immunoglobulin heavy chain variable (VH) region gene taken from the mouse hybridoma NL-1 cells which produce an antibody capable of commonly recognizing surface antigens of various human acute lyphocytic leukemia cells. Accordingly, if, for example, it is combined with a heavy chain constant (CH) region gene, a heavy chain can be produced which can recognize commonly various human acute lymphocytic leukemia cells in combination with a proper light chain. This would serve for the diagnosis and treatment of human acute lymphocytic leukemia.
|
