| 摘要 |
Specific oligonucleotide segments were prepd. and linked to a cloned DNA coding segment in seguence that confers desired functional properties on the expression of the protein coded by the DNA coding seguence. Thus, the DNA linder sequence 5'GATGATGATGATAAA-3' was chem. synthesized by the phosphotriester method of K. Itakura. The linker sequence was bluntend ligated to com. available Hind III linker which, when cleaved by Hind III endonuclease, yields a specific cleavage linker for insertion at a Hind III site. The product linker nucleotide sequences for both strands were AGCTTGGATGATGATGATAAA (plus end) and ACCTACTACTACTATTT (minus end). The specific cleavage linker is blunt-end ligated with the cloned human proinsulin gene to produce a deoxynucleotide sequence of the plus strand contg. 5'-Hind III linker-specific cleavage linker-human proinsulin gene-3'.
|
