| 摘要 |
PROBLEM TO BE SOLVED: To provide a method for accurately and easily assaying HBV(hepatitis B virus) in a highly sensitive way, by a real-time detection PCR technique using specific primers. SOLUTION: This method uses an oligonucleotide having consecutive 15 to 41 bases of the base sequence, TGGAGAACATCACATCAGGATTCCTAGGAC CCCTGCTCGTG, as a forward- side primer and another oligonucleotide having consecutive 15 to 39 bases of the base sequence, ACAGGAGGTTGGTGAGTGATTGGAGGTTGGGGAC TGCGA, as a reverse-side primer. A base sequence; CACATCAGGATTCCTAGGACC, preferable as the forward-side primer is equivalent to the nucleotide from the 12th. to the 32nd. bases of the S region of HBV genome. |
