摘要 |
Method for constructing replicable recombined vector for the production of a probe detecting hepatitis B virus and/or for biosynthesis of a HBV antigenic polypeptide, characterised in that the replicable vector combines with the DNA sequence with the formula (X)a-(Y)b-(Z)c, where a=1, b=1-15, c=1, X stands for the sequence: 5' AATTCAATAAG 3', Y stands for the sequence: 5' AATCCGCTGGGTTTCTTCCCGGATCACCAGCTGGATCCGGCTTTTGGTGCTAACTCTAACAACCCGGATTGGGATTTCAACCCGAATAAG 3', Z stands for the sequence: 5' AATCCGCTGTAATCTAGATTGCCGCCAGTTCCGCTGGCGGCATTTTA 3'<IMAGE>
|