摘要 |
Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer. |