Anvendelse af farmaceutiske præparater til behandling af neurodegenerative sygdomme

摘要

Use of a cpd (A) that (partly) inhibits interaction between sequence (I) and transcription factors (TF) to prepare a compsn. for treating and/or preventing neurodegenerative disease is new. AGCCGCAAGTGACTCAGCGCG4C (I) Also new are: (1) recombinant virus having inserted in its genome at least one double-stranded nucleic acid (B) corresponding to the site of interaction of TF on DNA; and (2) pharmaceutical compsns. contg. (B) complexed with DEAE-dextran, nuclear proteins or lipids, either in crude form or incorporated into liposomes.