| 摘要 |
Detection and/or quantification of minority variants, having at least one mutation, in a heterogeneous population of viruses, present in a biological sample. Detection and/or quantification of minority variants, having at least one mutation, in a heterogeneous population of viruses, present in a biological sample. Nucleic acids (I) are extracted from the sample and amplified by polymerase chain reaction (PCR), using primers that flank a viral sequence (Ia) suspected of carrying a mutation. Separately a standard amplicon is prepared similarly, from a sequence known to carry the mutation. Both amplicons are then subjected to real-time PCR using: (i) a pair of highly conserved primers that do not differentiate between mutated and non-mutated sequences, then quantifying the number of viral (I), mutated or not, present in the sample; and (ii) a pair of primers that are mutation specific, and quantifying the number of mutant sequences in the sample. Comparison of the results of (i) and (ii) gives the proportion of mutant viruses in the population. Independent claims are also included for the following: (1) pairs of primers (a) and (b); (c) and (d); (d) and (e), and (d) and (f) (a) CTTTAGCTTCCCTCAGATCACTC; (b) CCTGGCTTTAATTTTACTGGTACA; (c) GGTACAGTATTAGTAGGACCTACA; (d) TGGTACAGTTTCAATAGGACTAAT; (e) TATTAGTAGGACCTACACCAGC; and (f) AACATAATTGGAAGAAATCAGA ; (2) the probe (g) CTCAGATTGGTTGCACTTTAAATTTTCC; and (3) kit for the process comprising primer pairs for the three amplifications; a probe that has conjugated to its 5' and 3'-ends, respectively, a fluorescent reporter and a fluorescence quencher, specific for the amplicons; standard (mutated) nucleic acid; products and reagents for performing PCR amplifications.
|
