Detecting Aspergillus nucleic acid in body samples by two-step polymerase chain reaction, for diagnosing aspergillosis

摘要

A method for detecting Aspergillus nucleic acid (I) in a body sample is new and comprises the isolation of (I) followed by a two-step polymerase chain reaction (PCR) amplification of any nucleic acid having a sequence essentially homologous to part of the 3'-end of the Aspergillus 18S rRNA gene using primers used in the first step that do not overlap with those in the second step. Independent claims are also included for the following: (1) the primers (a)-(d), or their functional equivalents or fragments: (a) CGGCCCTTAAATAGCCCG; (b) GACCGGGTTTGACCAACTTT; (c) AGGGCCAGCGAGTACATCACCTTG; (d) GGGAGTCGTTGCCAACTCCCCTGA; and (2) a diagnostic kit .